FALL '14 1242014- Missing Weeks 11,12&13 Week 14 & 15 INHIBITION ASSAYS
Compounds ranked 12, 18, and 20 were chosen and ordered for inhibition assay screenings in wet lab based on a LogP value less than 3.5 and within Price Groups 0-3.
The initial screening was done using 300 uM and 500 uM concentrations of novel compounds.
The second inhibition screening focused on the #12 compound with the concentrations 50 uM, 100 uM, and 500 uM.
A control was executed for each experimental group, denoted by the "C", which replaced the novel compounds with 50% DMSO - 50% Water.
The third inhibition assay was conducted similarly as the previous one, except compound #20 was used this time.
DMSO was concluded to have no effect to the reaction, so it didn't decrease or increase the activity of the enzyme. Any inconsistencies in the data may be due to failure to clean the cuvettes or other technical errors in the reaction solution.
Compound #12 absorbance values did not prove to be reflective of an inhibitor compound since the numbers are all over the place and had no distinguishable pattern.
Compound #20 seemed promising, however, the sudden increase in absorbance at 500 uM of compound is the opposite of what an inhibitor should be. Free phosphate in the solution increased instead of decreased. Its values in other concentrations do not correlate with that result, so another inhibition assay with this compound will have to be conducted. Week 11, 12, & 13 ENZYME ASSAYS Using the BioMol Reagent, the compounds were tested at 620 nm using the Vernier Spectrophotometer CHIPPER. Standards were first tested to determine the positive reaction of BioMol to the presence of phosphate in the solution.
Enzyme assays were conducted using the following final concentrations: 50 mM Tris-HCl, 10 mM MgCl2, 10 mM KCl at pH 7.8, 20 mM D-alanine, 2.2 mM MtDdla enzyme, and 6 mM ATP. BioMol Green was added to the reaction after 10 minutes of incubation.
A final enzyme concentration of 2.2 mM was defined as the concentration to be used for future inhibition enzymes in order to ensure that reaction will happen.
1132014- Nice work , dont forget your analysisWeek 8 & 9
3rd Round of Protein Expression, Purification, and FPLC
The sample with 1M NaCl concentration was the one that underwent FPLC.
The samples with 0.750 M and 0.500 M NaCl are left in the 4-degree Celsius refrigerator.
These were diluted with buffer containing only 100 mM Tris and 300 mM Imidazole.
The graph still shows two peak sizes: 60 kDa and 80 kDa.
The 1M NaCl + MtDdla concentration was diluted with more Elution BUFFER (100 mM Tris, 1M NaCl, 300 mM Imidazole), so the yield is low, as indicated by the small absorbance peaks.
Both do contain D-alanine:D-alanine as proven by the Mass Spectrometry results, so enzyme assays will have to be conducted on the two separated samples to determine which peak actually works.
Figure 1: Absorbance vs. Wavelength of MtDdla at 280 nm before FPLC (ELUTION 1 with 1M NaCl).
The absorbance of the MtDdla had an average value of 0.37, with the concentration average being 0.375 mg/ml. The 260/280 value was at 1.63 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
Figure 2: Absorbance vs. Wavelength of MtDdla at 280 nm after FPLC.
The absorbance of the MtDdla sample with the 60 kDa peak had an average value of 0.874, with the concentration average being 0.875 mg/ml. The 260/280 value was at 0.73 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
Figure 3: Absorbance vs. Wavelength of MtDdla at 280 nm after FPLC.
The absorbance of the MtDdla sample with the 80 kDa peak had an average value of 0.643, with the concentration average being 0.65 mg/ml. The 260/280 value was at 1.955 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
9232014- Great job Week 5, 6, & 7 Mass Spectrometry
To determine the contents of the 60 kDa peak of MtDdla from the 2nd FPLC round, a 50 ul tube was sent for Mass Spectrometry Protein ID testing in the MBB building.
Results will come in this upcoming week.
Figure 1: SDS-PAGE gel for 2nd round of FPLC of MtDdla protein.
Lane 1: Protein Ladder
Lane 2: Pre-Induction
Lane 3: Post-Induction
Lane 4: Soluble Fraction
Lane 5: Flow through
Lane 6: Wash
Lane 7: Elution 1
Lane 8: Elution 2
Figure 2: Absorbance vs. Wavelength of MtDdla (60 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 2.420 and a concentration of 2.42 at 280 nm. The 260/280 value is 0.70. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 3: Absorbance vs. Wavelength of MtDdla (60 kDa) at 280 nm.
The second sample reading of MtDdla gave an absorbance of 2.180 and a concentration of 2.19 at 280 nm. The 260/280 value is 0.71. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 4: Absorbance vs. Wavelength of MtDdla (80 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 1.144 and a concentration of 1.14 at 280 nm. The 260/280 value is 1.24. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 5: Absorbance vs. Wavelength of MtDdla (80 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 1.116 and a concentration of 1.11 at 280 nm. The 260/280 value is 1.24. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
09232014- Great images but you might want to include captions and work on your formatting
Week 4 In this protein expression, I did Option B instead of A (as on the first expression round), so I made my overnight culture at night and expressed in the morning, giving my culture more time to grow. The second FPLC resulted in the same two peaks that came from the first FPLC, but in a smaller absorbance level. This can be blamed due to the removal of half of the resin in the Bio-Rad column, which allowed less protein to attach to the nickel in the resin. So the lower concentration is reflected in the FPLC graph. This round, the smaller peak is ~80 kDa and the higher peak is ~60 kDa which is opposite of the results from the first FPLC graph. Since the expression, purification, and FPLC process were done in a matter of 3 days, this may have given my protein less time to dimerize before FPLC, so the ~80 kDa peak is smaller in that sense. However, the ~60 kDa still does not make sense in that it doesn’t correspond to the size of my protein as a monomer or as a dimer. The solution that has come up is to send the ~60 kDa sample to Mass Spectrometry in order to determine the make up of that protein sample. This will hopefully tell us if this protein is MtDdla or a contaminant protein. To avoid dimerization altogether, it has been suggested to conduct protein purification and FPLC in succession. These two purification steps would have to be done in the same day to hopefully only produce one peak in the FPLC graph. Another solution to prevent the production of the ~80 kDa peak would be to change the pH levels of the storage buffers used for FPLC. Research would have to be done to see how pH levels affects protein stability specifically for my protein. The pH may have a hand in making MtDdla not stay in its monomer state. An error I made right before FPLC was spilling some of my sample before injection into the machine, so that made me lose some absorbance. I already had less than 1 ml of sample after concentrating, so that meant I only had ~0.5 ml left.
Week 3 The first FPLC has two peaks located at approximately 80 kDa and 60 kDa. This is unusual in that my protein MtDdla has a molecular weight of 39,710.2 Da. MtDdla however does exist as a dimer in biological environment, so the ~80 kDa peak makes sense. The reason for that is because a storage buffer is used during FPLC, which may imitate the biological environment that MtDdla needs to perform as a dimer. For protein characterization (pg. 71) the samples are heat blocked to denature the protein, which breaks the proteins apart into their monomer structures, thus giving us a band at ~40 kDa. The second peak located at ~60 kDa is more of a mystery because it is neither the size of my protein as a monomer nor as a dimer. An explanation for this unknown size might be a contaminant protein, a contaminant protein attaching to an MtDdla monomer, or an MtDdla dimer that has started to degrade, causing a protein that is one and a half size. Tubes 22 through 29 were collected for peak ~80 kDa, while tubes 30 through 37 were taken for ~60 kDa. There were numerous situations that could have caused errors. This expression was started at the beginning of August and stored in the -80 degrees Celsius freezer for almost a month until school began again and I continued with sonication. After purification, the Elution 1 sample was stored in the -4 degree Celsius refrigerator for 5 days before I proceeded to FPLC, so it gave my protein sample a chance to precipitate, even if slightly. I tried correcting this by spinning my sample to remove any pellets. Another round of expression will have to be conducted to obtain more results. This time, protein expression, purification, and FPLC will have to be conducted in a faster manner as to avoid any issues like precipitation or automatic dimerization of my proteins while in the -4 degrees Celsius fridge.
Week 2 Protein Characterization
The dark bands on lanes 3-7 corresponds to the size of MtDdla: 39.7 kDa.
Lane 1: Protein Size Marker
Lane 2: Cell Lysate Post-Induction
Lane 3: Soluble Fraction
Lane 4: Flow through
Lane 5: Wash
Lane 6: Elution 1
Lane 7: Elution 2
Protein Purification
A new Bio-Rad chromatography column was obtained for the first protein purification of my protein sample.
1 ml of Ni-NTA slurry (resin + buffer) was added into the sample and incubated for 45 minutes. This, however, has to be corrected in the next expression, purification, and characterization process because 1 ml is too much resin. Too much resin allows more proteins to bind to the nickel than wanted, which then causes unknown proteins to go through the column.
The sample was allowed to flow through, then the following solutions were added to continue on the purification process:
5 ml of Wash Buffer - Wash
2 ml Elution Buffer - Elution #1
4 ml Elution Buffer - Elution #2.
Absorbance vs. Wavelength of MtDdla Elution 1 using Protein-280.
The first sample reading of purified MtDdla gave an absorbance of 4.525 and a concentration of 4.53 at 280 nm. The 260/280 value is 0.89. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 1 using Protein-280.The second sample reading of purified MtDdla gave an absorbance of 4.601 and a concentration of 4.60 at 280 nm. The 260/280 value is 0.89. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 2 using Protein-280.The first sample reading of purified MtDdla gave an absorbance of 0.220 and a concentration of 0.22 at 280 nm. The 260/280 value is 1.21. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 2 using Protein-280.The second sample reading of purified MtDdla gave an absorbance of 0.233 and a concentration of 0.23 at 280 nm. The 260/280 value is 1.20. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Protein Expression (cont'd)
The samples left in the -80 degrees Celsius freezer was thawed and sonicated. After sonication, the solution was spun down. The pH level of the sample had to be within the 7.5-8 range, and it had an acceptable pH of 7.9. The protein solution was then syringe filtered with a 0.45 PES filter and a 10 ml syringe and stored in the -20 degrees Celsius for protein purification.
Week 1
HALF WEEK!
Came in to lab, but did not conduct any procedures.
SUMMER '14 Week 9 PROTEIN EXPRESSION
MtDdla clone was put through transformation in BL21(DE3) competent cells and grown on LB + kan plates.
In the protocol, Option A was chosen, and Day 2 started at 8 am.
Small cultures were grown for 8 hours, then the Large culture step began at 5 in the afternoon.
+12 ml = 0.0
+8 ml = 0.013
+4 ml = 0.022
+8 ml = 0.038
The OD reading at 600 nm did not reach the 0.1 target (only got to 0.038), but I went ahead and left it in the shaking incubator for 45 minutes before checking the OD reading again.
IPTG was then added. The calculated value was 262 ul. The solution was then left in a room temperature shaker for 18 hours.
The next day, the sample underwent centrifugation in a JA-10 rotor for 20 minutes. The pellet (weighed 3.79 g) was resuspended in lysis buffer in a 15-ml conical tube and stored in the -80 degrees Celsius freezer until school begins again. The process will then proceed on to sonication. Absorbance vs. Wavelength of Tube 8 from Master Plate D. The first sample has an absorbance of 0.993 with a concentration of 60.2 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Absorbance vs. Wavelength of Tube 8 from Master Plate D. The second sample has an absorbance of 0.984 with a concentration of 59.8 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
: Absorbance vs. Wavelength of the positive clone from Master Plate D. The first sample has an absorbance of 0.196 with a concentration of 31.9 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Absorbance vs. Wavelength of the positive clone from Master Plate D. The second sample has an absorbance of 0.216 with a concentration of 32.4 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Growing of positively cloned MtDdla+pNIC-Bsa4 in BL21(DE3) competent cells for protein expression.
Positive clone of MtDdla + pNIC-Bsa4 in Ca++ competent cells. DNA Sequence of the positive clone of MtDdla+pNIC using pLIC-forward primer.There's a 98% identities; the 2% mismatch is caused by the unsequenced "N"s and insertions and deletions. DNA Sequence of the positive clone of MtDdla+pNIC using pLIC-reverse primer. There's a 96% identities; the 4% mismatch is caused by the unsequenced "N"s and insertions and deletions.
The insertions and deletions were due to technical misreadings of the DNA sequencing machine. Since the gene is so big (more than 1000 nucleotides) it can't be read perfectly clear at the ends of the gene. Therefore, the two sequences were compared to clear up any presence of insertions and deletions. 18 tubes were Mini-Prepped and sent in for samples at this round. (Master Plate C and D)10 of these samples came from Master Plate C because of the numerous colonies present on the plate, so more colonies were tested aside from the colonies sent in for sequencing the week before. Only forward sequencing were done on these.8 of the samples came from the 3rd cloning round (Master Plate D). Forward and reverse pLIC primers were used for sequencing, and these correspond to the Samples MCB1 through MCB16.ONE positive clone came from all these DNA sequences, which is MCB15 and MCB16. This is tube #8 from the 3rd round of cloning. Week 8 Another round of cloning started with the making of more Secondary PCR samples because I ran out.Secondary PCR and PCR squared was annealed at 65 degrees Celsius as edited before. 3rd Round of CloningTube A: 2 ul Accepting Vector + 4 ul PCR insertTube B: 1 ul AV + 5 ul PCRTube C: 1 ul + 4 ulTube D: 1 ul + 6 ulTube E: 2 ul + 6 ul Submitted 8 colonies from this round of cloning.Results are shown on Week 9 above. DNA Sequencing results from Week 7 came in, and no positive clones were obtained.The results were blasted in NCBI BlastN, and the images showed that the ends of the gene where pNIC-Bsa4 was attached is the only section being cloned.Some showed small pieces of the gene in the center, but no full positive clone was made. Week 7 Charina - ok good. We'll see how the colonies turn out.Go ahead and start your next cloning rounds. - Dr. B 072114
Restriction Enzyme Digest for MtDdla with pNIC-Bsa4 using EcoRI enzyme.
ERROR: Uncut pNIC-Bsa4 used on lane 2 is actually pGBR22 with a concentration of 316.3 ng/ul.
The lower band for lanes 4 through 7 are supposed to be at a smaller base pair length (~1000), so the MtDdla restriction enzyme samples were cut at a different length than expected. DNA sequencing results will be needed in order to confirm true identity of samples. Lane 1: 1 kb DNA ladderLane 2: Uncut pNIC-Bsa4 plasmid (316.3 ng/ul)Lane 3: EcoRI digest of pNIC-Bsa4Lane 4: EcoRI digest of Tube 1 (133 ng/ul)Lane 5: EcoRI digest of Tube 2 (106.5 ng/ul)
Lane 6: EcoRI digest of Tube 3 (70.7 ng/ul)
Lane 7: EcoRI digest of Tube 4 (88 ng/ul)
Lanes 8-10: PCR2 of MtDdla
Custom Digest for pNIC-Bsa4 with MtDdla insert using EcoR1
Temperature Gradient on Secondary PCR Agarose gel for secondary PCR of MtDdla with temperature gradient. Lane 2 contains the 1kb ladder, and lanes 3 through 10 have the samples of MtDdla run at different temperatures.
The sample in lane 3 will be used for PCR squared because it anneals at a higher temperature; hopefully, the contamination band at 500 bp will not be able to replicate at such a high temperature since small lengths of genes need lower temperatures to have primers bind to them.
Lane 2: 1 kb DNA ladderLane 3: Annealing temp of 65 degrees CelsiusLane 4: Annealing temp of 64.5 degrees CelsiusLane 5: Annealing temp of 63.7 degrees CelsiusLane 6: Annealing temp of 62.4 degrees Celsius
Lane 7: Annealing temp of 60.8 degrees CelsiusLane 8: Annealing temp of 59.6 degrees CelsiusLane 9: Annealing temp of 58.7 degrees Celsius Lane 10: Annealing temp of 58 degrees Celsius
PCR Squared Round 2 Agarose gel for restriction PCR2 of D-ala-D-ala oligo mixture, secondary PCR of GES-5, andrestriction enzyme digest of pNIC-Bsa4. Lanes 4 through 6 show contamination at the 500 bp mark,while lane 6 shows no bands. Lane 8 has a band around the 1000 bp mark; lane 9 contains the sample ofpNIC-Bsa4 that underwent restriction enzyme digest with BsaI enzymes.Increasing the annealing temperature didn't remove the lower band at the 500 bp length, so small amounts must have been present at secondary PCR that can't be seen in the agarose gel.It will be necessary to do a temperature gradient on secondary PCR and find the highest temperature that the gene is able to multiply without expressing the unknown 500 bp band. Lane 1 & 2: Empty Lane 3: 1 kb DNA ladder Lane 4: PCR2 at 63.7 degrees annealing temp (Charina) Lane 5: PCR2 at 62.4 degrees annealing temp Lane 6: PCR2 at 60.8 degrees annealing temp Lane 7: PCR2 at 59.6 degrees annealing temp Lane 8: Secondary PCR for GES-5 (Brianna) Lane 9: Restriction Enzyme Digest of pNIC-Bsa4 (Brianna)
=
pNIC-Bsa4 cut with BsaI
=
Lane 1: 1 kb DNA ladderLanes 2 & 3: Prepared pNIC-Bsa4 cut with BsaI
RE digest of pNIC-Bsa4 using the enzyme BsaI.
Using BsaI cuts out the SacB gene from pNIC-Bsa4, making it able to survive in a plate with LB + Kanamycin + Sucrose.
Week 6
Great progress, and good concentration. Keep up the good work. Did you do RE Digest? -Grace
7/15/14
MtDdla Post PCR Clean-Up
Absorbance vs. Wavelength (nm) of MtDdla sample after PCR Clean Up. The absorbance is measured at 1.115, while the concentration is 125.9 ng/ul. The 260/280 and 260/230 values are 1.87 and 2.26, respectively. These were all measured at a wavelength of 230 nm, which is represented by the blue vertical line on the graph.
PCR Squared
The purpose of PCR squared is to amplify the DNA sample produced from the secondary PCR.
Lane 3 was loaded with the 1 kb DNA ladder, and lanes 4 through 7 contain the PCR samples from each 50 aliquot tubes.
The top bands are of similar length to the band produced in secondary PCR, but the presence of the lower bands are unexpected. That may be due to contamination, a wrong mixture of primers that amplified another section of mixed oligos, or an unforeseen reason that Dr. B will have to explain later.
Hopefully, PCR Clean Up will remove the DNA sections that correspond to the lower band and leave us only with the top band.
Secondary PCR
Agarose gel for MtDdla oligo mix after Secondary PCR. For the first gel, lanes 4 and 5 were used. However, the sample did not appear, which could be due to an improperly made mixture, bad Q5 dilution, or letting the sample sit out of the -20 degrees Celsius for too long. The secondary PCR sample used on the second gel, on the right, was made from a new secondary PCR mix. Lanes 3 and 4 were used to load the 1 kb DNA ladder and the sample of secondary PCR primer mix, respectively. Lane 4 on the gel on the right shows a single band that corresponds to the length expressed with the addition of MtDdla forward and reverse primer tails made and ordered.
Primary PCR
Agarose gel for D-ala:D-ala ligase primary PCR. Lane 1 contains the 1 kb DNA ladder, while lane 2 has the sample of primary PCR for D-ala-D-ala. The second lane shows the expected streak because no primer has been added, so all the DNA lengths are present.
Lane 1: 1 kb DNA ladder
Lane 2: Primary PCR for D-ala-D-ala.
Restriction Enzyme Digest
Agarose gel for pGBR22 after Restriction Enzyme Digest. Lane 1 has the 1kb DNA ladder, and lane 2 contains the sample of uncut pGBR22 template. Lanes 3, and 6 have the sample cut with EcoRI; lanes 4, and 7 are cut with PvuII; lanes 5, 8 and 9 are cut by the two restriction enzymes. The lanes that were cut with the same enzymes show similar amounts and placement of bands along the lanes. The ones cut with EcoRI show 1 band, PvuII show 2 bands, and the ones cut with both enzymes have 3 bands. Chris Tran, Hailey Welch, & Charina BenavidezRestriction Enzyme Digest gelpGBR22VDS Summer ‘14July 7, 2014
FIRST GEL Lane 1: 1 kb DNA ladder Lane 2: Uncut DNA template Lane 3: EcoRI digest (Hailey) Lane 4: PvuII digest Lane 5: EcoRI and PvuII digest Lane 6: EcoRI digest (Zain) Lane 7: PvuII digest Lane 8: EcoRI and PvuII digest Lane 9: EcoRI digest (Charina) Lane 10: PvuII digest
SECOND GEL Lane 10: EcoRI and PvuII digest (Charina)
Week 5 Charina - not sure if I want to know where that pic was taken! Good image of the gel and good labeling. The nano drop readings are not for post FPLC - right? It will be interesting to see the final yield there. Any PCR gels for this week? You can post them even if they 'failed' because they still give us information. -- Dr. B Researchers outside of lab. (: DNA sequence for Mycobacterium Tuberculosis from DNA Works Ouput. ATGTCTGCTAACGACCGCCGTGACCGTCGCGTTCGCGTCGCTGTTGTGTTCGGTGGCCGC TCTAACGAACACGCCATCTCTTGCGTTTCTGCGGGTTCTATCCTGCGTAATCTCGACTCT CGCCGTTTCGACGTTATCGCGGTAGGCATCACCCCGGCAGGCTCCTGGGTTCTGACCGAT GCGAACCCGGACGCACTGACCATTACTAACCGTGAACTCCCGCAGGTAAAATCTGGTTCT GGTACGGAGCTGGCACTGCCTGCGGACCCTCGTCGTGGTGGCCAACTCGTTTCTCTCCCA CCGGGTGCGGGCGAAGTTCTGGAATCTGTTGACGTTGTTTTCCCAGTTCTGCACGGCCCG TATGGTGAAGATGGTACGATCCAGGGCCTGCTGGAGCTCGCGGGTGTACCTTATGTTGGT GCAGGTGTTCTCGCGTCTGCGGTGGGTATGGACAAAGAATTCACCAAAAAACTGCTGGCA GCAGATGGCCTCCCAGTAGGTGCCTACGCGGTCCTCCGTCCGCCTCGTTCTACCCTCCAT CGTCAAGAATGCGAGCGTCTGGGTCTGCCGGTTTTCGTTAAACCTGCCCGTGGCGGCTCT TCTATTGGTGTTTCTCGTGTTTCCTCTTGGGATCAGCTCCCTGCGGCAGTTGCGCGTGCC CGTCGCCATGACCCGAAAGTTATCGTTGAAGCGGCGATCTCTGGTCGTGAGCTGGAATGT GGTGTCCTGGAAATGCCGGACGGTACCCTCGAAGCGTCTACTCTGGGCGAAATTCGTGTG GCAGGCGTGCGTGGCCGTGAGGACTCTTTCTACGACTTTGCGACCAAATATCTGGACGAC GCAGCCGAACTGGATGTTCCGGCGAAGGTTGATGATCAGGTGGCTGAAGCTATCCGTCAG CTCGCAATTCGCGCATTCGCTGCGATTGACTGCCGTGGCCTCGCACGTGTGGACTTCTTC CTGACTGATGATGGTCCGGTGATCAACGAGATCAACACTATGCCGGGCTTTACTACCATT TCTATGTACCCGCGTATGTGGGCGGCATCTGGCGTTGATTACCCGACCCTGCTCGCGACC ATGATCGAAACCACCCTGGCTCGTGGCGTCGGTCTCCATTAA
Protein Characterization
PAGE Gel for FtHap after expression and purification.
CORRECTION: Lane 1 is SIZE MARKER, not DNA ladder.
Lane 1: Size marker.
Lane 2: Pre-Induction (before addition of IPTG)
Lane 3: Post-Induction (after addition of IPTG)
Lane 4: Soluble fraction
Lane 5: Flow through
Lane 6: Wash (after wash buffer was added)
Lane 7: Elution #1 (after addition of 2ml of Elution Buffer)
Lane 8: Elution #2 (after additional 4ml of Elution Buffer)
Samples 0 through 6 correspond to lanes 2 through 8 in this PAGE gel.
Pre-induction sample does not show any bands that indicate the presence of the protein because the IPTG, which activates the production of the protein, has not been added. Post-induction sample has a band that shows the protein, but the concentration of other proteins also increased.
Soluble fraction has an even stronger concentration of all the proteins present in the sample, making it hard to distinguish where the protein exactly is on the band. Flow through is very similar to soluble fraction, with the band of the protein less thick.
The wash sample has a low, if any, concentration of the protein, which is the expected result because the wash buffer is supposed to allow the weaker binding proteins to go through the filter and leave the FtHap protein in the filter.
Elution 1 shows a thick band of protein along with contamination and other proteins.
Elution 2 is a much purer sample with a clear band of FtHap protein present and a small amount of contamination on the other lengths.
FPLC
My FtHap sample used for FPLC was mixed together with Luis and Andrei's FtHap sample, giving us a total of 7.5ml of Elution 1 solution.
Our combined samples were concentrated using a filtering tube and the centrifuge in the back of the lab to a 1ml concentrated sample.
The sample became sticky after leaving it out of ice, so another sample had to be taken after returning the sample back in the ice bucket.
This graph shows the concentration of the sample before FPLC was performed.
There are two nanodrop readings for our Post-FPLC because our FtHap samples were concentrated in two different batches.
The absorbance of the first half of the Nanodrop sample, taken at 280 nm, is 3.384. The concentration in uM after being imputed in the Protein Spectrophotometer Calculations is 63.43 uM.
The absorbance of the second half of the Nanodrop sample, taken at 280 nm, is 2.56. The concentration in uM after being imputed in the Protein Spectrophotometer Calculations is 48.04 uM, which is lower than the 50-100 uM range that we were aiming for, but the concentration is close enough.
Each spin down left us with ~100 ul of concentrated sample, giving us a total of ~200 ul of FtHap sample.
Week 4
Charina - that is a great yield for the FtHap. I think we should have enough for FPLC. However, I will wait to see how the PAGE gel comes out. For the DNA agarose gels - I am not sure how good it is to have the photo of the lab book page - your's is readable - but I am afraid of other getting in the habit and uploading poor quality images where you can't actually read the gel. The ideal way is to have the image as a separate TIFF or JPEG. The gels look good though. - Dr. B
Protein Purification
Elution 1 is the flow through collected after the first addition of 2 ml of Elution Buffer.
Elution 2 is the flow through collected after the 2nd addition of 4 ml of Elution Buffer.
Figure 1: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 1.
Sample 1 has an absorbance value of 2.304 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 2: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 1.
Sample 2 has an absorbance value of 2.290 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 3: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 2.
Sample 1 has an absorbance value of 0.832 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 4: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 2.
Sample 2 has an absorbance value of 0.787 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Protein Expression for FtHap + pNIC-Bsa4 had to be redone because sample after sonication was misplaced and could not be found.
6/25/14
Added bacteria = OD reading
+10 ml = 0.026
+10 ml = 0.077
+5 ml = 0.095
+0.5 ml = 0.104
Time (PM) = OD reading
12:15 = 0.104
12:49 = 0.126
1:09 = 0.170
1:46 = 0.304
2:19 = 0.472
After harvested by centrifugation, the weight of the pellet was 10.40 g. It was then stored in the -80 degrees Celsius freezer.
PCR
Run 2
The 100 bp ladder was expressed, but it still did not spread out the way the ladder is supposed to. The Lanes with the PCR samples did not appear just like in Run 1. The pGBR22 plasmid used was different from the one used in Run 1; the concentration is larger (255 ng/ul). New DNA template dilutions were made, but the M13 forward and reverse primers used were the leftovers used from the first PCR, so that could have contributed to the failure of the agarose gel. The agarose powder used for the creation of the gel was also increased from 0.7 to 0.8 g.
Run 3
CORRECTION: Contamination is present on lanes 4 and 8.
A different M13 forward and reverse primer dilutions were used for this third run, so this possibly contributed to the success of this gel. The same pGBR22 sample was used from Run 2 (255 ng/ul). The 100 bp failed to work for the third time, but the 1 kb was spread out nicely. The 1 kb was added 1 minute after the agarose gel was started, so the rest of the DNA samples already started running down the gel a little bit before we added the 1 kb. The increase in intensity of the bands from lanes 6, 7, and 8 correspond to the increase in DNA template concentration present in the samples from tubes A through C. The agarose powder added is similar to Run 2.
Figure 2: DNA Sequencing results for pNIC-Bsa4 that ran through Midi-Prep. The pLIC-rev primer was used on this sample.
Week 3
Transformation for FtHap with pNIC-Bsa4 plasmid in BL21(DE3) Competent Cells
A concentration of 63.4 ng/ul of FtHap plasmid sample was used. 50 ng of DNA was needed, so upon Dr. B's instructions, 1 ul of DNA was combined with 50 ul of BL21(DE3) in a 14 mL transformation tube. 63.4 ng is close enough to the required 50 ng, and it does not hurt to have more DNA plasmids in this case. The mixture was kept in ice for 20 minutes, heat shocked for 30 seconds, and went back into ice for 2 minutes. 250 ul of SOC media was added after the ice step, and the solution was placed in the shaking incubator for approximately 30 minutes with an RPM of 176 and a temperature of about 37 degrees Celsius. There were a lot of flasks being put inside the incubator at the same time, so there were constant interruptions in the shaking incubator cycle. To compensate for this, I kept the transformation tube in the shaking incubator for an extra 30 minutes, totaling an hour in the shaking incubator. This may have affected the growth of the bacteria in a negative way since the incubation was not done in a continuous manner.
I used LB Agar plates with Kanamycin to grow the FtHap colonies on: one with 10 ul and the other with 50 ul of FtHap with pNIC-Bsa4. The colonies grown from this plate will be used for protein expression, purification, and characterization.
Figure 3: Plate of FtHap + pNIC-Bsa4 with 50 ul of DNA plasmid solution. This plate is used for the protein expression of FtHap.
Day 2 (PROTEIN EXPRESSION)
Overnight Culture of FtHap with pNIC-Bsa4Two 250-ml Erlenmeyer flasks were filled with 50 ml of LB media each. A 1-to-1 Kanamycin to LB media ratio was added into the LB, so 50 ul of Kanamycin was added into the solution. From the 50 ul plate of FtHap with pNIC-Bsa4 already made, a colony was inserted into each flask using a 10 ul pipette tip (the tips are ejected into the flasks).They are then grown in the 37-degree shaking incubator overnight.
Day3
Large Culture Step
10 AM
A liter of LB media needed to be warmed in the shaking incubator for about 30 minutes. In a 2-L Erlenmeyer flask, 500 ml of LB media and 500 ul of Kanamycin were added together. With a sterile environment, an initial amount of 10 or 12 ml of the grown culture is poured into the mixture. The OD(600) is measured with the Vernier Visible Spec (Chipper). Different amounts of bacteria culture are added into the LB mixture until the OD reading reaches 0.1 at 600 nm. The time each measurement was taken, the reading value, and the amount of culture added is recorded on a labeling tape on the flask.
Added bacteria = OD reading
+12 ml = 0.38
+8 ml = 0.086
+1 ml = 0.072
+1 ml = 0.123
After an OD of 0.1 was achieved, the solution was placed back in the shaking incubator for 45 minutes before doing another reading. A reading was taken after 30 minutes, 15 minutes, and at varying times depending on when the solution reached an OD of 0.5.
Time (PM) = OD reading
12:28 = 0.091
12:59 = 0.121
1:32 = 0.195
2:06 = 0.365
FtHap is a slow-growing plasmid, so the IPTG was added after a reading of 0.365 to save time.
Sample #0 is taken as Cell Lysate before Induction. A calculated amount of 1M IPTG was added after for a 500 uM final concentration to induce expression of T7 polymerase. Choosing Option B, the mixture is allowed to grow on shaker for 4 hours at 37 degrees Celsius in the big shaking incubator. Sample #1 is taken as Cell Lysate after Induction.
The mixture was then transfered to a 500 ml clear cylindrical bottles to be centrifuged in the Beckman centrifuge in the Bioprospecting Lab (Brown Lab). The bottles are balanced and topped with nanopure water as needed. The solution was cetrifuged for 20 minutes at 6000 g (5750 RPM as shown in the chart on the centrifuge). The supernatant was then poured out as waste, the pellet was weighed (tare an empty cylindrical bottle for subtraction), and the pellet was finally resuspended in 10 ml of lysis buffer.
The pellet weighed 10.97 g.
The new mixture was transferred to a 15 ml screw cap conical tube and stored in -80 degrees Celsius.
Day 4
Sonication
Sonication was done in the Biotech Lab (WEL 3.270).
The tube was submerged in a beaker filled with ice, and loaded onto the platform to where the sonicator tip didn't touch the bottom of the tube.
The Output control was set at 5.5, and the following cycle was executed:
1x30 sec at 70% duty cycle, wait 1 minute on ice.
1x30 sec at 70%, wait 1 minutes on ice.
1x30 sec at 90%, wait 3 minutes on ice.
1x30 sec at 90%, wait 3 minutes on ice.
The Spin Down step was saved for another day, so our sample was stored in the -20-degree freezer.
PCR & Agarose Gel
To make a 1% agarose gel, we first had to make a 1x TAE buffer from the 50x TAE stock solution.
Run 1
The pGBR22 used had a concentration of 170 ng/ul. Lanes 2-5 are not visible (5 is the control, so no DNA template). The ladder appears like it ran too close together, without spaces in between. Since PCR samples are not present in the Ultraviolet view of the gel, there could have been a mistake made during the PCR process. Our DNA plasmids could have died during the addition of TAQ polymerase because we were too slow, the M13 forward and reverse used could have been bad reagents, or somewhere along the mixture with the gel loading buffer (blue juice) we left our samples on the parafilm for too long. Run 2 and 3 were conducted during Week 4.
Figure 1: DNA sequencing results for 2nd time on pGFp using M13 Forward (M13-for) primer. The concentration of pGFp is 79.4 ng/ul, different from the plasmid sample used on week 1. N represents the nucleotides that could not be determined by the program.
Figure 2: Absorbance vs. Wavelength (nm) for pNIC-Bsa4 taken after Midi-Prep.The first sample (left) had a concentration of 79.8 ng/ul, and the second sample (right) had a concentration of 84.1 ng/ul. The blue vertical line represented where 230 nm was on the graph; the black solid line traced the absorbance of the sample at different wavelengths.
AAAAhhhhhhhhhhhhh - put some Week 3 stuff up. - Dr. B
Figure 1: DNA sequencing results for pGFp using M13 Forward (M13-for) primer. N represents the nucleotides that could not be determined by the program.
Transformation Efficiency
Figure 2: Plate A with 1 ng of 1:100 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 3: Plate B with 5 ng of 1:10 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 4: Plate C with 25 ng of 1:2 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 5: Control plate with DH5alpha bacterial cells and SOC media mixture on agar with kanamycin plate.
1242014- Missing Weeks 11,12&13
Week 14 & 15
INHIBITION ASSAYS
Compounds ranked 12, 18, and 20 were chosen and ordered for inhibition assay screenings in wet lab based on a LogP value less than 3.5 and within Price Groups 0-3.
The initial screening was done using 300 uM and 500 uM concentrations of novel compounds.
The second inhibition screening focused on the #12 compound with the concentrations 50 uM, 100 uM, and 500 uM.
A control was executed for each experimental group, denoted by the "C", which replaced the novel compounds with 50% DMSO - 50% Water.
The third inhibition assay was conducted similarly as the previous one, except compound #20 was used this time.
DMSO was concluded to have no effect to the reaction, so it didn't decrease or increase the activity of the enzyme. Any inconsistencies in the data may be due to failure to clean the cuvettes or other technical errors in the reaction solution.
Compound #12 absorbance values did not prove to be reflective of an inhibitor compound since the numbers are all over the place and had no distinguishable pattern.
Compound #20 seemed promising, however, the sudden increase in absorbance at 500 uM of compound is the opposite of what an inhibitor should be. Free phosphate in the solution increased instead of decreased. Its values in other concentrations do not correlate with that result, so another inhibition assay with this compound will have to be conducted.
Week 11, 12, & 13
ENZYME ASSAYS
Using the BioMol Reagent, the compounds were tested at 620 nm using the Vernier Spectrophotometer CHIPPER.
Standards were first tested to determine the positive reaction of BioMol to the presence of phosphate in the solution.
Enzyme assays were conducted using the following final concentrations:
50 mM Tris-HCl, 10 mM MgCl2, 10 mM KCl at pH 7.8, 20 mM D-alanine, 2.2 mM MtDdla enzyme, and 6 mM ATP. BioMol Green was added to the reaction after 10 minutes of incubation.
A final enzyme concentration of 2.2 mM was defined as the concentration to be used for future inhibition enzymes in order to ensure that reaction will happen.
1132014- Nice work , dont forget your analysisWeek 8 & 9
3rd Round of Protein Expression, Purification, and FPLC
The sample with 1M NaCl concentration was the one that underwent FPLC.
The samples with 0.750 M and 0.500 M NaCl are left in the 4-degree Celsius refrigerator.
These were diluted with buffer containing only 100 mM Tris and 300 mM Imidazole.
The graph still shows two peak sizes: 60 kDa and 80 kDa.
The 1M NaCl + MtDdla concentration was diluted with more Elution BUFFER (100 mM Tris, 1M NaCl, 300 mM Imidazole), so the yield is low, as indicated by the small absorbance peaks.
Both do contain D-alanine:D-alanine as proven by the Mass Spectrometry results, so enzyme assays will have to be conducted on the two separated samples to determine which peak actually works.
Figure 1: Absorbance vs. Wavelength of MtDdla at 280 nm before FPLC (ELUTION 1 with 1M NaCl).
The absorbance of the MtDdla had an average value of 0.37, with the concentration average being 0.375 mg/ml. The 260/280 value was at 1.63 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
Figure 2: Absorbance vs. Wavelength of MtDdla at 280 nm after FPLC.
The absorbance of the MtDdla sample with the 60 kDa peak had an average value of 0.874, with the concentration average being 0.875 mg/ml. The 260/280 value was at 0.73 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
Figure 3: Absorbance vs. Wavelength of MtDdla at 280 nm after FPLC.
The absorbance of the MtDdla sample with the 80 kDa peak had an average value of 0.643, with the concentration average being 0.65 mg/ml. The 260/280 value was at 1.955 in average for both samples. The blue line indicated where 280 was on the graph, while the black line traced the absorbance of the sample at various wavelengths.
9232014- Great job
Week 5, 6, & 7
Mass Spectrometry
To determine the contents of the 60 kDa peak of MtDdla from the 2nd FPLC round, a 50 ul tube was sent for Mass Spectrometry Protein ID testing in the MBB building.
Results will come in this upcoming week.
Figure 1: SDS-PAGE gel for 2nd round of FPLC of MtDdla protein.
Lane 1: Protein Ladder
Lane 2: Pre-Induction
Lane 3: Post-Induction
Lane 4: Soluble Fraction
Lane 5: Flow through
Lane 6: Wash
Lane 7: Elution 1
Lane 8: Elution 2
Figure 2: Absorbance vs. Wavelength of MtDdla (60 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 2.420 and a concentration of 2.42 at 280 nm. The 260/280 value is 0.70. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 3: Absorbance vs. Wavelength of MtDdla (60 kDa) at 280 nm.
The second sample reading of MtDdla gave an absorbance of 2.180 and a concentration of 2.19 at 280 nm. The 260/280 value is 0.71. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 4: Absorbance vs. Wavelength of MtDdla (80 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 1.144 and a concentration of 1.14 at 280 nm. The 260/280 value is 1.24. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Figure 5: Absorbance vs. Wavelength of MtDdla (80 kDa) at 280 nm.
The first sample reading of MtDdla gave an absorbance of 1.116 and a concentration of 1.11 at 280 nm. The 260/280 value is 1.24. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
09232014- Great images but you might want to include captions and work on your formatting
Week 4
In this protein expression, I did Option B instead of A (as on the first expression round), so I made my overnight culture at night and expressed in the morning, giving my culture more time to grow.
The second FPLC resulted in the same two peaks that came from the first FPLC, but in a smaller absorbance level. This can be blamed due to the removal of half of the resin in the Bio-Rad column, which allowed less protein to attach to the nickel in the resin. So the lower concentration is reflected in the FPLC graph.
This round, the smaller peak is ~80 kDa and the higher peak is ~60 kDa which is opposite of the results from the first FPLC graph. Since the expression, purification, and FPLC process were done in a matter of 3 days, this may have given my protein less time to dimerize before FPLC, so the ~80 kDa peak is smaller in that sense. However, the ~60 kDa still does not make sense in that it doesn’t correspond to the size of my protein as a monomer or as a dimer.
The solution that has come up is to send the ~60 kDa sample to Mass Spectrometry in order to determine the make up of that protein sample. This will hopefully tell us if this protein is MtDdla or a contaminant protein. To avoid dimerization altogether, it has been suggested to conduct protein purification and FPLC in succession. These two purification steps would have to be done in the same day to hopefully only produce one peak in the FPLC graph. Another solution to prevent the production of the ~80 kDa peak would be to change the pH levels of the storage buffers used for FPLC. Research would have to be done to see how pH levels affects protein stability specifically for my protein. The pH may have a hand in making MtDdla not stay in its monomer state.
An error I made right before FPLC was spilling some of my sample before injection into the machine, so that made me lose some absorbance. I already had less than 1 ml of sample after concentrating, so that meant I only had ~0.5 ml left.
Week 3
The first FPLC has two peaks located at approximately 80 kDa and 60 kDa. This is unusual in that my protein MtDdla has a molecular weight of 39,710.2 Da. MtDdla however does exist as a dimer in biological environment, so the ~80 kDa peak makes sense. The reason for that is because a storage buffer is used during FPLC, which may imitate the biological environment that MtDdla needs to perform as a dimer. For protein characterization (pg. 71) the samples are heat blocked to denature the protein, which breaks the proteins apart into their monomer structures, thus giving us a band at ~40 kDa.
The second peak located at ~60 kDa is more of a mystery because it is neither the size of my protein as a monomer nor as a dimer. An explanation for this unknown size might be a contaminant protein, a contaminant protein attaching to an MtDdla monomer, or an MtDdla dimer that has started to degrade, causing a protein that is one and a half size.
Tubes 22 through 29 were collected for peak ~80 kDa, while tubes 30 through 37 were taken for ~60 kDa.
There were numerous situations that could have caused errors. This expression was started at the beginning of August and stored in the -80 degrees Celsius freezer for almost a month until school began again and I continued with sonication. After purification, the Elution 1 sample was stored in the -4 degree Celsius refrigerator for 5 days before I proceeded to FPLC, so it gave my protein sample a chance to precipitate, even if slightly. I tried correcting this by spinning my sample to remove any pellets.
Another round of expression will have to be conducted to obtain more results. This time, protein expression, purification, and FPLC will have to be conducted in a faster manner as to avoid any issues like precipitation or automatic dimerization of my proteins while in the -4 degrees Celsius fridge.
Week 2
Protein Characterization
The dark bands on lanes 3-7 corresponds to the size of MtDdla: 39.7 kDa.
Lane 1: Protein Size Marker
Lane 2: Cell Lysate Post-Induction
Lane 3: Soluble Fraction
Lane 4: Flow through
Lane 5: Wash
Lane 6: Elution 1
Lane 7: Elution 2
Protein Purification
A new Bio-Rad chromatography column was obtained for the first protein purification of my protein sample.
1 ml of Ni-NTA slurry (resin + buffer) was added into the sample and incubated for 45 minutes. This, however, has to be corrected in the next expression, purification, and characterization process because 1 ml is too much resin. Too much resin allows more proteins to bind to the nickel than wanted, which then causes unknown proteins to go through the column.
The sample was allowed to flow through, then the following solutions were added to continue on the purification process:
5 ml of Wash Buffer - Wash
2 ml Elution Buffer - Elution #1
4 ml Elution Buffer - Elution #2.
Absorbance vs. Wavelength of MtDdla Elution 1 using Protein-280.
The first sample reading of purified MtDdla gave an absorbance of 4.525 and a concentration of 4.53 at 280 nm. The 260/280 value is 0.89. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 1 using Protein-280.The second sample reading of purified MtDdla gave an absorbance of 4.601 and a concentration of 4.60 at 280 nm. The 260/280 value is 0.89. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 2 using Protein-280.The first sample reading of purified MtDdla gave an absorbance of 0.220 and a concentration of 0.22 at 280 nm. The 260/280 value is 1.21. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Absorbance vs. Wavelength of MtDdla Elution 2 using Protein-280.The second sample reading of purified MtDdla gave an absorbance of 0.233 and a concentration of 0.23 at 280 nm. The 260/280 value is 1.20. The blue vertical line indicates 280 nm on the graph, while the black line traces the absorbance of the solution through various wavelengths.
Protein Expression (cont'd)
The samples left in the -80 degrees Celsius freezer was thawed and sonicated. After sonication, the solution was spun down. The pH level of the sample had to be within the 7.5-8 range, and it had an acceptable pH of 7.9. The protein solution was then syringe filtered with a 0.45 PES filter and a 10 ml syringe and stored in the -20 degrees Celsius for protein purification.
Week 1
HALF WEEK!
Came in to lab, but did not conduct any procedures.
SUMMER '14
Week 9
PROTEIN EXPRESSION
MtDdla clone was put through transformation in BL21(DE3) competent cells and grown on LB + kan plates.
In the protocol, Option A was chosen, and Day 2 started at 8 am.
Small cultures were grown for 8 hours, then the Large culture step began at 5 in the afternoon.
+12 ml = 0.0
+8 ml = 0.013
+4 ml = 0.022
+8 ml = 0.038
The OD reading at 600 nm did not reach the 0.1 target (only got to 0.038), but I went ahead and left it in the shaking incubator for 45 minutes before checking the OD reading again.
6:29 pm = 0.107
7:30 pm = 0.446
7:38 pm = 0.454
7:45 pm = 0.507
IPTG was then added. The calculated value was 262 ul. The solution was then left in a room temperature shaker for 18 hours.
The next day, the sample underwent centrifugation in a JA-10 rotor for 20 minutes. The pellet (weighed 3.79 g) was resuspended in lysis buffer in a 15-ml conical tube and stored in the -80 degrees Celsius freezer until school begins again. The process will then proceed on to sonication.
Absorbance vs. Wavelength of Tube 8 from Master Plate D. The first sample has an absorbance of 0.993 with a concentration of 60.2 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Absorbance vs. Wavelength of Tube 8 from Master Plate D. The second sample has an absorbance of 0.984 with a concentration of 59.8 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
: Absorbance vs. Wavelength of the positive clone from Master Plate D. The first sample has an absorbance of 0.196 with a concentration of 31.9 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Absorbance vs. Wavelength of the positive clone from Master Plate D. The second sample has an absorbance of 0.216 with a concentration of 32.4 ng/ul. The blue vertical line indicates 230 nm on the graph, while the black line traces the absorbance of the sample at different wavelengths.
Growing of positively cloned MtDdla+pNIC-Bsa4 in BL21(DE3) competent cells for protein expression.
Positive clone of MtDdla + pNIC-Bsa4 in Ca++ competent cells.
DNA Sequence of the positive clone of MtDdla+pNIC using pLIC-forward primer.There's a 98% identities; the 2% mismatch is caused by the unsequenced "N"s and insertions and deletions.
DNA Sequence of the positive clone of MtDdla+pNIC using pLIC-reverse primer. There's a 96% identities; the 4% mismatch is caused by the unsequenced "N"s and insertions and deletions.
The insertions and deletions were due to technical misreadings of the DNA sequencing machine. Since the gene is so big (more than 1000 nucleotides) it can't be read perfectly clear at the ends of the gene. Therefore, the two sequences were compared to clear up any presence of insertions and deletions.
18 tubes were Mini-Prepped and sent in for samples at this round. (Master Plate C and D)10 of these samples came from Master Plate C because of the numerous colonies present on the plate, so more colonies were tested aside from the colonies sent in for sequencing the week before. Only forward sequencing were done on these.8 of the samples came from the 3rd cloning round (Master Plate D). Forward and reverse pLIC primers were used for sequencing, and these correspond to the Samples MCB1 through MCB16.ONE positive clone came from all these DNA sequences, which is MCB15 and MCB16. This is tube #8 from the 3rd round of cloning.
Week 8
Another round of cloning started with the making of more Secondary PCR samples because I ran out.Secondary PCR and PCR squared was annealed at 65 degrees Celsius as edited before.
3rd Round of CloningTube A: 2 ul Accepting Vector + 4 ul PCR insertTube B: 1 ul AV + 5 ul PCRTube C: 1 ul + 4 ulTube D: 1 ul + 6 ulTube E: 2 ul + 6 ul
Submitted 8 colonies from this round of cloning.Results are shown on Week 9 above.
DNA Sequencing results from Week 7 came in, and no positive clones were obtained.The results were blasted in NCBI BlastN, and the images showed that the ends of the gene where pNIC-Bsa4 was attached is the only section being cloned.Some showed small pieces of the gene in the center, but no full positive clone was made.
Week 7
Charina - ok good. We'll see how the colonies turn out.Go ahead and start your next cloning rounds. - Dr. B 072114
DNA Sequencing
Samples 1 & 2: Tube 1
Samples 3 & 4: Tube 2
Samples 5 & 6: Tube 3
Samples 7 & 8: Tube 4
Restriction Enzyme Digest for MtDdla with pNIC-Bsa4 using EcoRI enzyme.
ERROR: Uncut pNIC-Bsa4 used on lane 2 is actually pGBR22 with a concentration of 316.3 ng/ul.
The lower band for lanes 4 through 7 are supposed to be at a smaller base pair length (~1000), so the MtDdla restriction enzyme samples were cut at a different length than expected. DNA sequencing results will be needed in order to confirm true identity of samples.
Lane 1: 1 kb DNA ladderLane 2: Uncut pNIC-Bsa4 plasmid (316.3 ng/ul)Lane 3: EcoRI digest of pNIC-Bsa4Lane 4: EcoRI digest of Tube 1 (133 ng/ul)Lane 5: EcoRI digest of Tube 2 (106.5 ng/ul)
Lane 6: EcoRI digest of Tube 3 (70.7 ng/ul)
Lane 7: EcoRI digest of Tube 4 (88 ng/ul)
Lanes 8-10: PCR2 of MtDdla
Custom Digest for pNIC-Bsa4 with MtDdla insert using EcoR1
Temperature Gradient on Secondary PCR
Agarose gel for secondary PCR of MtDdla with temperature gradient. Lane 2 contains the 1kb ladder, and lanes 3 through 10 have the samples of MtDdla run at different temperatures.
The sample in lane 3 will be used for PCR squared because it anneals at a higher temperature; hopefully, the contamination band at 500 bp will not be able to replicate at such a high temperature since small lengths of genes need lower temperatures to have primers bind to them.
Lane 2: 1 kb DNA ladderLane 3: Annealing temp of 65 degrees CelsiusLane 4: Annealing temp of 64.5 degrees CelsiusLane 5: Annealing temp of 63.7 degrees CelsiusLane 6: Annealing temp of 62.4 degrees Celsius
Lane 7: Annealing temp of 60.8 degrees CelsiusLane 8: Annealing temp of 59.6 degrees CelsiusLane 9: Annealing temp of 58.7 degrees Celsius
Lane 10: Annealing temp of 58 degrees Celsius
PCR Squared Round 2
Agarose gel for restriction PCR2 of D-ala-D-ala oligo mixture, secondary PCR of GES-5, andrestriction enzyme digest of pNIC-Bsa4. Lanes 4 through 6 show contamination at the 500 bp mark,while lane 6 shows no bands. Lane 8 has a band around the 1000 bp mark; lane 9 contains the sample ofpNIC-Bsa4 that underwent restriction enzyme digest with BsaI enzymes.Increasing the annealing temperature didn't remove the lower band at the 500 bp length, so small amounts must have been present at secondary PCR that can't be seen in the agarose gel.It will be necessary to do a temperature gradient on secondary PCR and find the highest temperature that the gene is able to multiply without expressing the unknown 500 bp band.
Lane 1 & 2: Empty
Lane 3: 1 kb DNA ladder
Lane 4: PCR2 at 63.7 degrees annealing temp (Charina)
Lane 5: PCR2 at 62.4 degrees annealing temp
Lane 6: PCR2 at 60.8 degrees annealing temp
Lane 7: PCR2 at 59.6 degrees annealing temp
Lane 8: Secondary PCR for GES-5 (Brianna)
Lane 9: Restriction Enzyme Digest of pNIC-Bsa4 (Brianna)
=
pNIC-Bsa4 cut with BsaI=
Lane 1: 1 kb DNA ladderLanes 2 & 3: Prepared pNIC-Bsa4 cut with BsaI
RE digest of pNIC-Bsa4 using the enzyme BsaI.
Using BsaI cuts out the SacB gene from pNIC-Bsa4, making it able to survive in a plate with LB + Kanamycin + Sucrose.Week 6
Great progress, and good concentration. Keep up the good work. Did you do RE Digest? -Grace
7/15/14
MtDdla Post PCR Clean-Up
Absorbance vs. Wavelength (nm) of MtDdla sample after PCR Clean Up. The absorbance is measured at 1.115, while the concentration is 125.9 ng/ul. The 260/280 and 260/230 values are 1.87 and 2.26, respectively. These were all measured at a wavelength of 230 nm, which is represented by the blue vertical line on the graph.
PCR Squared
The purpose of PCR squared is to amplify the DNA sample produced from the secondary PCR.
Lane 3 was loaded with the 1 kb DNA ladder, and lanes 4 through 7 contain the PCR samples from each 50 aliquot tubes.
The top bands are of similar length to the band produced in secondary PCR, but the presence of the lower bands are unexpected. That may be due to contamination, a wrong mixture of primers that amplified another section of mixed oligos, or an unforeseen reason that Dr. B will have to explain later.
Hopefully, PCR Clean Up will remove the DNA sections that correspond to the lower band and leave us only with the top band.
Secondary PCR
Agarose gel for MtDdla oligo mix after Secondary PCR.
For the first gel, lanes 4 and 5 were used. However, the sample did not appear, which could be due to an improperly made mixture, bad Q5 dilution, or letting the sample sit out of the -20 degrees Celsius for too long.
The secondary PCR sample used on the second gel, on the right, was made from a new secondary PCR mix. Lanes 3 and 4 were used to load the 1 kb DNA ladder and the sample of secondary PCR primer mix, respectively. Lane 4 on the gel on the right shows a single band that corresponds to the length expressed with the addition of MtDdla forward and reverse primer tails made and ordered.
Primary PCR
Agarose gel for D-ala:D-ala ligase primary PCR. Lane 1 contains the 1 kb DNA ladder, while lane 2 has the sample of primary PCR for D-ala-D-ala. The second lane shows the expected streak because no primer has been added, so all the DNA lengths are present.
Lane 1: 1 kb DNA ladder
Lane 2: Primary PCR for D-ala-D-ala.
Restriction Enzyme Digest
Agarose gel for pGBR22 after Restriction Enzyme Digest. Lane 1 has the 1kb DNA ladder, and lane 2 contains the sample of uncut pGBR22 template. Lanes 3, and 6 have the sample cut with EcoRI; lanes 4, and 7 are cut with PvuII; lanes 5, 8 and 9 are cut by the two restriction enzymes. The lanes that were cut with the same enzymes show similar amounts and placement of bands along the lanes. The ones cut with EcoRI show 1 band, PvuII show 2 bands, and the ones cut with both enzymes have 3 bands.
Chris Tran, Hailey Welch, & Charina BenavidezRestriction Enzyme Digest gelpGBR22VDS Summer ‘14July 7, 2014
FIRST GEL
Lane 1: 1 kb DNA ladder
Lane 2: Uncut DNA template
Lane 3: EcoRI digest (Hailey)
Lane 4: PvuII digest
Lane 5: EcoRI and PvuII digest
Lane 6: EcoRI digest (Zain)
Lane 7: PvuII digest
Lane 8: EcoRI and PvuII digest
Lane 9: EcoRI digest (Charina)
Lane 10: PvuII digest
SECOND GEL
Lane 10: EcoRI and PvuII digest (Charina)
Week 5
Charina - not sure if I want to know where that pic was taken! Good image of the gel and good labeling. The nano drop readings are not for post FPLC - right? It will be interesting to see the final yield there. Any PCR gels for this week? You can post them even if they 'failed' because they still give us information. -- Dr. B
Researchers outside of lab. (:
DNA sequence for Mycobacterium Tuberculosis from DNA Works Ouput.
ATGTCTGCTAACGACCGCCGTGACCGTCGCGTTCGCGTCGCTGTTGTGTTCGGTGGCCGC TCTAACGAACACGCCATCTCTTGCGTTTCTGCGGGTTCTATCCTGCGTAATCTCGACTCT CGCCGTTTCGACGTTATCGCGGTAGGCATCACCCCGGCAGGCTCCTGGGTTCTGACCGAT GCGAACCCGGACGCACTGACCATTACTAACCGTGAACTCCCGCAGGTAAAATCTGGTTCT GGTACGGAGCTGGCACTGCCTGCGGACCCTCGTCGTGGTGGCCAACTCGTTTCTCTCCCA CCGGGTGCGGGCGAAGTTCTGGAATCTGTTGACGTTGTTTTCCCAGTTCTGCACGGCCCG TATGGTGAAGATGGTACGATCCAGGGCCTGCTGGAGCTCGCGGGTGTACCTTATGTTGGT GCAGGTGTTCTCGCGTCTGCGGTGGGTATGGACAAAGAATTCACCAAAAAACTGCTGGCA GCAGATGGCCTCCCAGTAGGTGCCTACGCGGTCCTCCGTCCGCCTCGTTCTACCCTCCAT CGTCAAGAATGCGAGCGTCTGGGTCTGCCGGTTTTCGTTAAACCTGCCCGTGGCGGCTCT TCTATTGGTGTTTCTCGTGTTTCCTCTTGGGATCAGCTCCCTGCGGCAGTTGCGCGTGCC CGTCGCCATGACCCGAAAGTTATCGTTGAAGCGGCGATCTCTGGTCGTGAGCTGGAATGT GGTGTCCTGGAAATGCCGGACGGTACCCTCGAAGCGTCTACTCTGGGCGAAATTCGTGTG GCAGGCGTGCGTGGCCGTGAGGACTCTTTCTACGACTTTGCGACCAAATATCTGGACGAC GCAGCCGAACTGGATGTTCCGGCGAAGGTTGATGATCAGGTGGCTGAAGCTATCCGTCAG CTCGCAATTCGCGCATTCGCTGCGATTGACTGCCGTGGCCTCGCACGTGTGGACTTCTTC CTGACTGATGATGGTCCGGTGATCAACGAGATCAACACTATGCCGGGCTTTACTACCATT TCTATGTACCCGCGTATGTGGGCGGCATCTGGCGTTGATTACCCGACCCTGCTCGCGACC ATGATCGAAACCACCCTGGCTCGTGGCGTCGGTCTCCATTAA
Protein Characterization
PAGE Gel for FtHap after expression and purification.
CORRECTION: Lane 1 is SIZE MARKER, not DNA ladder.
Lane 1: Size marker.
Lane 2: Pre-Induction (before addition of IPTG)
Lane 3: Post-Induction (after addition of IPTG)
Lane 4: Soluble fraction
Lane 5: Flow through
Lane 6: Wash (after wash buffer was added)
Lane 7: Elution #1 (after addition of 2ml of Elution Buffer)
Lane 8: Elution #2 (after additional 4ml of Elution Buffer)
Samples 0 through 6 correspond to lanes 2 through 8 in this PAGE gel.
Pre-induction sample does not show any bands that indicate the presence of the protein because the IPTG, which activates the production of the protein, has not been added. Post-induction sample has a band that shows the protein, but the concentration of other proteins also increased.
Soluble fraction has an even stronger concentration of all the proteins present in the sample, making it hard to distinguish where the protein exactly is on the band. Flow through is very similar to soluble fraction, with the band of the protein less thick.
The wash sample has a low, if any, concentration of the protein, which is the expected result because the wash buffer is supposed to allow the weaker binding proteins to go through the filter and leave the FtHap protein in the filter.
Elution 1 shows a thick band of protein along with contamination and other proteins.
Elution 2 is a much purer sample with a clear band of FtHap protein present and a small amount of contamination on the other lengths.
FPLC
My FtHap sample used for FPLC was mixed together with Luis and Andrei's FtHap sample, giving us a total of 7.5ml of Elution 1 solution.
Our combined samples were concentrated using a filtering tube and the centrifuge in the back of the lab to a 1ml concentrated sample.
The sample became sticky after leaving it out of ice, so another sample had to be taken after returning the sample back in the ice bucket.
This graph shows the concentration of the sample before FPLC was performed.
There are two nanodrop readings for our Post-FPLC because our FtHap samples were concentrated in two different batches.
The absorbance of the first half of the Nanodrop sample, taken at 280 nm, is 3.384. The concentration in uM after being imputed in the Protein Spectrophotometer Calculations is 63.43 uM.
The absorbance of the second half of the Nanodrop sample, taken at 280 nm, is 2.56. The concentration in uM after being imputed in the Protein Spectrophotometer Calculations is 48.04 uM, which is lower than the 50-100 uM range that we were aiming for, but the concentration is close enough.
Each spin down left us with ~100 ul of concentrated sample, giving us a total of ~200 ul of FtHap sample.
Week 4
Charina - that is a great yield for the FtHap. I think we should have enough for FPLC. However, I will wait to see how the PAGE gel comes out. For the DNA agarose gels - I am not sure how good it is to have the photo of the lab book page - your's is readable - but I am afraid of other getting in the habit and uploading poor quality images where you can't actually read the gel. The ideal way is to have the image as a separate TIFF or JPEG. The gels look good though. - Dr. B
Protein Purification
Elution 1 is the flow through collected after the first addition of 2 ml of Elution Buffer.
Elution 2 is the flow through collected after the 2nd addition of 4 ml of Elution Buffer.
Figure 1: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 1.
Sample 1 has an absorbance value of 2.304 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 2: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 1.
Sample 2 has an absorbance value of 2.290 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 3: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 2.
Sample 1 has an absorbance value of 0.832 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Figure 4: Absorbance vs. Wavelength (nm) of FtHap + pNIC-Bsa4 protein in Elution 2.
Sample 2 has an absorbance value of 0.787 measured at 280 nm. The solid blue vertical line indicates where 280 nm is on the graph, and the black line traces the absorbance path of the sample at different wavelengths.
Protein Expression for FtHap + pNIC-Bsa4 had to be redone because sample after sonication was misplaced and could not be found.
6/25/14Added bacteria = OD reading
+10 ml = 0.026
+10 ml = 0.077
+5 ml = 0.095
+0.5 ml = 0.104
Time (PM) = OD reading
12:15 = 0.104
12:49 = 0.126
1:09 = 0.170
1:46 = 0.304
2:19 = 0.472
After harvested by centrifugation, the weight of the pellet was 10.40 g. It was then stored in the -80 degrees Celsius freezer.
PCR
Run 2
The 100 bp ladder was expressed, but it still did not spread out the way the ladder is supposed to. The Lanes with the PCR samples did not appear just like in Run 1. The pGBR22 plasmid used was different from the one used in Run 1; the concentration is larger (255 ng/ul). New DNA template dilutions were made, but the M13 forward and reverse primers used were the leftovers used from the first PCR, so that could have contributed to the failure of the agarose gel. The agarose powder used for the creation of the gel was also increased from 0.7 to 0.8 g.
Run 3
CORRECTION: Contamination is present on lanes 4 and 8.
A different M13 forward and reverse primer dilutions were used for this third run, so this possibly contributed to the success of this gel. The same pGBR22 sample was used from Run 2 (255 ng/ul). The 100 bp failed to work for the third time, but the 1 kb was spread out nicely. The 1 kb was added 1 minute after the agarose gel was started, so the rest of the DNA samples already started running down the gel a little bit before we added the 1 kb. The increase in intensity of the bands from lanes 6, 7, and 8 correspond to the increase in DNA template concentration present in the samples from tubes A through C. The agarose powder added is similar to Run 2.
DNA Sequence for pNIC-Bsa4 after Midi-Prep
Figure 1: DNA Sequencing results for pNIC-Bsa4 that ran through Midi-Prep. The pLIC-for primer was used on this sample.Figure 2: DNA Sequencing results for pNIC-Bsa4 that ran through Midi-Prep. The pLIC-rev primer was used on this sample.
Week 3Transformation for FtHap with pNIC-Bsa4 plasmid in BL21(DE3) Competent Cells
A concentration of 63.4 ng/ul of FtHap plasmid sample was used. 50 ng of DNA was needed, so upon Dr. B's instructions, 1 ul of DNA was combined with 50 ul of BL21(DE3) in a 14 mL transformation tube. 63.4 ng is close enough to the required 50 ng, and it does not hurt to have more DNA plasmids in this case. The mixture was kept in ice for 20 minutes, heat shocked for 30 seconds, and went back into ice for 2 minutes. 250 ul of SOC media was added after the ice step, and the solution was placed in the shaking incubator for approximately 30 minutes with an RPM of 176 and a temperature of about 37 degrees Celsius. There were a lot of flasks being put inside the incubator at the same time, so there were constant interruptions in the shaking incubator cycle. To compensate for this, I kept the transformation tube in the shaking incubator for an extra 30 minutes, totaling an hour in the shaking incubator. This may have affected the growth of the bacteria in a negative way since the incubation was not done in a continuous manner.I used LB Agar plates with Kanamycin to grow the FtHap colonies on: one with 10 ul and the other with 50 ul of FtHap with pNIC-Bsa4. The colonies grown from this plate will be used for protein expression, purification, and characterization.
Figure 3: Plate of FtHap + pNIC-Bsa4 with 50 ul of DNA plasmid solution. This plate is used for the protein expression of FtHap.
Day 2 (PROTEIN EXPRESSION)
Overnight Culture of FtHap with pNIC-Bsa4Two 250-ml Erlenmeyer flasks were filled with 50 ml of LB media each. A 1-to-1 Kanamycin to LB media ratio was added into the LB, so 50 ul of Kanamycin was added into the solution. From the 50 ul plate of FtHap with pNIC-Bsa4 already made, a colony was inserted into each flask using a 10 ul pipette tip (the tips are ejected into the flasks).They are then grown in the 37-degree shaking incubator overnight.
Day 3
Large Culture Step
10 AM
A liter of LB media needed to be warmed in the shaking incubator for about 30 minutes. In a 2-L Erlenmeyer flask, 500 ml of LB media and 500 ul of Kanamycin were added together. With a sterile environment, an initial amount of 10 or 12 ml of the grown culture is poured into the mixture. The OD(600) is measured with the Vernier Visible Spec (Chipper). Different amounts of bacteria culture are added into the LB mixture until the OD reading reaches 0.1 at 600 nm. The time each measurement was taken, the reading value, and the amount of culture added is recorded on a labeling tape on the flask.
Added bacteria = OD reading
+12 ml = 0.38
+8 ml = 0.086
+1 ml = 0.072
+1 ml = 0.123
After an OD of 0.1 was achieved, the solution was placed back in the shaking incubator for 45 minutes before doing another reading. A reading was taken after 30 minutes, 15 minutes, and at varying times depending on when the solution reached an OD of 0.5.
Time (PM) = OD reading
12:28 = 0.091
12:59 = 0.121
1:32 = 0.195
2:06 = 0.365
Sample #0 is taken as Cell Lysate before Induction. A calculated amount of 1M IPTG was added after for a 500 uM final concentration to induce expression of T7 polymerase. Choosing Option B, the mixture is allowed to grow on shaker for 4 hours at 37 degrees Celsius in the big shaking incubator. Sample #1 is taken as Cell Lysate after Induction.
The mixture was then transfered to a 500 ml clear cylindrical bottles to be centrifuged in the Beckman centrifuge in the Bioprospecting Lab (Brown Lab). The bottles are balanced and topped with nanopure water as needed. The solution was cetrifuged for 20 minutes at 6000 g (5750 RPM as shown in the chart on the centrifuge). The supernatant was then poured out as waste, the pellet was weighed (tare an empty cylindrical bottle for subtraction), and the pellet was finally resuspended in 10 ml of lysis buffer.
The pellet weighed 10.97 g.
The new mixture was transferred to a 15 ml screw cap conical tube and stored in -80 degrees Celsius.
Day 4
Sonication
Sonication was done in the Biotech Lab (WEL 3.270).
The tube was submerged in a beaker filled with ice, and loaded onto the platform to where the sonicator tip didn't touch the bottom of the tube.
The Output control was set at 5.5, and the following cycle was executed:
1x30 sec at 70% duty cycle, wait 1 minute on ice.
1x30 sec at 70%, wait 1 minutes on ice.
1x30 sec at 90%, wait 3 minutes on ice.
1x30 sec at 90%, wait 3 minutes on ice.
The Spin Down step was saved for another day, so our sample was stored in the -20-degree freezer.
PCR & Agarose Gel
To make a 1% agarose gel, we first had to make a 1x TAE buffer from the 50x TAE stock solution.
Run 1
The pGBR22 used had a concentration of 170 ng/ul. Lanes 2-5 are not visible (5 is the control, so no DNA template). The ladder appears like it ran too close together, without spaces in between. Since PCR samples are not present in the Ultraviolet view of the gel, there could have been a mistake made during the PCR process. Our DNA plasmids could have died during the addition of TAQ polymerase because we were too slow, the M13 forward and reverse used could have been bad reagents, or somewhere along the mixture with the gel loading buffer (blue juice) we left our samples on the parafilm for too long. Run 2 and 3 were conducted during Week 4.
Figure 1: DNA sequencing results for 2nd time on pGFp using M13 Forward (M13-for) primer. The concentration of pGFp is 79.4 ng/ul, different from the plasmid sample used on week 1. N represents the nucleotides that could not be determined by the program.
Figure 2: Absorbance vs. Wavelength (nm) for pNIC-Bsa4 taken after Midi-Prep.The first sample (left) had a concentration of 79.8 ng/ul, and the second sample (right) had a concentration of 84.1 ng/ul. The blue vertical line represented where 230 nm was on the graph; the black solid line traced the absorbance of the sample at different wavelengths.
AAAAhhhhhhhhhhhhh - put some Week 3 stuff up. - Dr. B
Week 1 and 2Figure 1: DNA sequencing results for pGFp using M13 Forward (M13-for) primer. N represents the nucleotides that could not be determined by the program.
Transformation Efficiency
Figure 2: Plate A with 1 ng of 1:100 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 3: Plate B with 5 ng of 1:10 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 4: Plate C with 25 ng of 1:2 pNIC-Bsa4, DH5alpha bacterial cells, and SOC media mixture on agar with kanamycin plate.
Figure 5: Control plate with DH5alpha bacterial cells and SOC media mixture on agar with kanamycin plate.